Melanin Biosynthesis
멜라닌 생합성
Sentence Examples
Discover more insights into Melanin Biosynthesis 멜라닌 생합성
Keywords frequently search together with Melanin Biosynthesis 멜라닌 생합성
Narrow sentence examples with built-in keyword filters
Melanin Biosynthesis sentence examples within microphthalmia associated transcription
Several external and internal factors control melanin biosynthesis and operate through different intracellular signaling pathways, which finally leads to the regulation of microphthalmia-associated transcription factor (MITF), the key transcription factor involved in melanogenesis and the expression of the main melanogenic enzymes, including TYR, TYRP-1, and TYRP-2.
여러 외부 및 내부 요인이 멜라닌 생합성을 제어하고 다양한 세포 내 신호 전달 경로를 통해 작동하며, 이는 최종적으로 멜라닌 생성 및 TYR을 포함한 주요 멜라닌 생성 효소의 발현과 관련된 주요 전사 인자인 소안구증 관련 전사 인자(MITF)의 조절로 이어집니다. , TYRP-1 및 TYRP-2.
여러 외부 및 내부 요인이 멜라닌 생합성을 제어하고 다양한 세포 내 신호 전달 경로를 통해 작동하며, 이는 최종적으로 멜라닌 생성 및 TYR을 포함한 주요 멜라닌 생성 효소의 발현과 관련된 주요 전사 인자인 소안구증 관련 전사 인자(MITF)의 조절로 이어집니다. , TYRP-1 및 TYRP-2.
Full Text
It significantly enhanced the expression of microphthalmia-associated transcription factor (MITF) and downstream enzymes of melanin biosynthesis-tyrosinase (TYR), tyrosinase-related protein (TRP-1), and dopachrome tautomerase (DCT).
그것은 소안구증 관련 전사 인자(MITF)와 멜라닌 생합성 티로시나아제(TYR), 티로시나아제 관련 단백질(TRP-1) 및 도파크롬 호변이성화효소(DCT)의 다운스트림 효소의 발현을 크게 향상시켰습니다.
그것은 소안구증 관련 전사 인자(MITF)와 멜라닌 생합성 티로시나아제(TYR), 티로시나아제 관련 단백질(TRP-1) 및 도파크롬 호변이성화효소(DCT)의 다운스트림 효소의 발현을 크게 향상시켰습니다.
Full Text
Melanin Biosynthesis sentence examples within Regulate Melanin Biosynthesis
As melanin plays an important photoprotective role in the risk of sun-induced skin cancers, we have investigated whether PRP4 can induce drug resistance and regulate melanin biosynthesis in a murine melanoma (B16F10) cell line.
멜라닌이 태양으로 인한 피부암의 위험에서 중요한 광보호 역할을 하기 때문에 우리는 PRP4가 쥐 흑색종(B16F10) 세포주에서 약물 내성을 유도하고 멜라닌 생합성을 조절할 수 있는지 여부를 조사했습니다.
멜라닌이 태양으로 인한 피부암의 위험에서 중요한 광보호 역할을 하기 때문에 우리는 PRP4가 쥐 흑색종(B16F10) 세포주에서 약물 내성을 유도하고 멜라닌 생합성을 조절할 수 있는지 여부를 조사했습니다.
Full Text
PfmaH, as a pathway specific regulator, mainly regulates melanin biosynthesis that contributes to cell wall development.
경로 특이적 조절자인 PfmaH는 주로 세포벽 발달에 기여하는 멜라닌 생합성을 조절합니다.
경로 특이적 조절자인 PfmaH는 주로 세포벽 발달에 기여하는 멜라닌 생합성을 조절합니다.
Full Text
Melanin Biosynthesis sentence examples within Promote Melanin Biosynthesis
CONCLUSION: Our data suggested that RBE promotes melanin biosynthesis.
결론: 우리의 데이터는 RBE가 멜라닌 생합성을 촉진함을 시사했습니다.
결론: 우리의 데이터는 RBE가 멜라닌 생합성을 촉진함을 시사했습니다.
Full Text
Together, these results suggest that RBM promotes melanin biosynthesis in zebrafish.
함께, 이러한 결과는 RBM이 제브라피쉬에서 멜라닌 생합성을 촉진함을 시사합니다.
함께, 이러한 결과는 RBM이 제브라피쉬에서 멜라닌 생합성을 촉진함을 시사합니다.
Full Text
Learn more from Melanin Biosynthesis 멜라닌 생합성
Melanin Biosynthesis sentence examples within Inhibit Melanin Biosynthesis
The results suggest that APC extract inhibits melanin biosynthesis by down-regulating microphthalmia-associated transcription factor (Mitf) and its downstream signaling pathway through JNK signaling activation, and the inhibition of Wnt/β-catenin and cAMP/PKA signaling pathways.
결과는 APC 추출물이 JNK 신호 활성화를 통해 소안구증 관련 전사 인자(Mitf) 및 그 다운스트림 신호 전달 경로를 하향 조절하고 Wnt/β-카테닌 및 cAMP/PKA 신호 전달 경로의 억제를 통해 멜라닌 생합성을 억제함을 시사합니다.
결과는 APC 추출물이 JNK 신호 활성화를 통해 소안구증 관련 전사 인자(Mitf) 및 그 다운스트림 신호 전달 경로를 하향 조절하고 Wnt/β-카테닌 및 cAMP/PKA 신호 전달 경로의 억제를 통해 멜라닌 생합성을 억제함을 시사합니다.
Full Text
IL-36γ (2 µg/ml) directly inhibits melanin biosynthesis in cultured human epidermal melanocytes (HEMs) and downregulates the gene transcription of key enzymes in the melanogenesis pathway including TYR, DCT, and TYRP1.
IL-36γ(2 µg/ml)는 배양된 인간 표피 멜라닌 세포(HEM)에서 멜라닌 생합성을 직접 억제하고 TYR, DCT 및 TYRP1을 포함한 멜라닌 생성 경로에서 주요 효소의 유전자 전사를 하향 조절합니다.
IL-36γ(2 µg/ml)는 배양된 인간 표피 멜라닌 세포(HEM)에서 멜라닌 생합성을 직접 억제하고 TYR, DCT 및 TYRP1을 포함한 멜라닌 생성 경로에서 주요 효소의 유전자 전사를 하향 조절합니다.
Full Text
Melanin Biosynthesis sentence examples within Control Melanin Biosynthesis
Several external and internal factors control melanin biosynthesis and operate through different intracellular signaling pathways, which finally leads to the regulation of microphthalmia-associated transcription factor (MITF), the key transcription factor involved in melanogenesis and the expression of the main melanogenic enzymes, including TYR, TYRP-1, and TYRP-2.
여러 외부 및 내부 요인이 멜라닌 생합성을 제어하고 다양한 세포 내 신호 전달 경로를 통해 작동하며, 이는 최종적으로 멜라닌 생성 및 TYR을 포함한 주요 멜라닌 생성 효소의 발현과 관련된 주요 전사 인자인 소안구증 관련 전사 인자(MITF)의 조절로 이어집니다. , TYRP-1 및 TYRP-2.
여러 외부 및 내부 요인이 멜라닌 생합성을 제어하고 다양한 세포 내 신호 전달 경로를 통해 작동하며, 이는 최종적으로 멜라닌 생성 및 TYR을 포함한 주요 멜라닌 생성 효소의 발현과 관련된 주요 전사 인자인 소안구증 관련 전사 인자(MITF)의 조절로 이어집니다. , TYRP-1 및 TYRP-2.
Full Text
The melanogenesis pathway, which controls melanin biosynthesis, was the most significantly enriched pathway in the DEGs between the two mantle regions, indicating its important role in shell pigmentation.
멜라닌 생합성을 조절하는 멜라닌 생성 경로는 두 맨틀 영역 사이의 DEG에서 가장 현저하게 풍부한 경로였으며, 이는 껍질 착색에서 중요한 역할을 나타냅니다.
멜라닌 생합성을 조절하는 멜라닌 생성 경로는 두 맨틀 영역 사이의 DEG에서 가장 현저하게 풍부한 경로였으며, 이는 껍질 착색에서 중요한 역할을 나타냅니다.
Full Text
Melanin Biosynthesis sentence examples within melanin biosynthesis pathway
Pigmentation patterns in Drosophila are formed by the deposition of different pigments synthesized in the developing epidermis and the role of cis-regulatory elements (CREs) of melanin biosynthesis pathway-related genes is well-characterized.
초파리의 색소 침착 패턴은 발달 중인 표피에서 합성된 다양한 색소의 침착에 의해 형성되며 멜라닌 생합성 경로 관련 유전자의 시스 조절 요소(CRE)의 역할은 잘 특성화되어 있습니다.
초파리의 색소 침착 패턴은 발달 중인 표피에서 합성된 다양한 색소의 침착에 의해 형성되며 멜라닌 생합성 경로 관련 유전자의 시스 조절 요소(CRE)의 역할은 잘 특성화되어 있습니다.
Full Text
As a proof of concept, we targeted the melanin biosynthesis pathway gene trihydroxynaphthalene reductase (THN), which has previously been shown to result in a light-brown colony phenotype when transcriptionally silenced using RNA interference.
개념 증명으로, 우리는 멜라닌 생합성 경로 유전자 트리하이드록시나프탈렌 환원효소(THN)를 표적으로 삼았습니다.
개념 증명으로, 우리는 멜라닌 생합성 경로 유전자 트리하이드록시나프탈렌 환원효소(THN)를 표적으로 삼았습니다.
Full Text
Melanin Biosynthesis sentence examples within melanin biosynthesis gene
In addition, the expression levels of MPG1, WISH, and PDEH in the cAMP-PKA pathway, RAS2 in both the cAMP-PKA and Pmk1 MAPK pathways, and melanin biosynthesis genes (ALB1, BUF1, and RSY1) were significantly down-regulated in the ∆Poral2.
또한, cAMP-PKA 경로에서 MPG1, WISH 및 PDEH, cAMP-PKA 및 Pmk1 MAPK 경로 모두에서 RAS2, 멜라닌 생합성 유전자(ALB1, BUF1 및 RSY1)의 발현 수준은 ∆포랄2.
또한, cAMP-PKA 경로에서 MPG1, WISH 및 PDEH, cAMP-PKA 및 Pmk1 MAPK 경로 모두에서 RAS2, 멜라닌 생합성 유전자(ALB1, BUF1 및 RSY1)의 발현 수준은 ∆포랄2.
Full Text
Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al.
ITS-rDNA 영역 및 Brn1 환원효소 멜라닌 생합성 유전자의 부분 서열은 프라이머 ITS1/ITS4(TCCGTAGGTGAACCTGGCGG/TCCTCCGCTTATTGATATGC)를 사용하여 증폭되었습니다(White et al.
ITS-rDNA 영역 및 Brn1 환원효소 멜라닌 생합성 유전자의 부분 서열은 프라이머 ITS1/ITS4(TCCGTAGGTGAACCTGGCGG/TCCTCCGCTTATTGATATGC)를 사용하여 증폭되었습니다(White et al.
Full Text
Melanin Biosynthesis sentence examples within melanin biosynthesis inhibitor
The fungicide tolprocarb (TPC) is a melanin biosynthesis inhibitor, but it may also have another mode of action.
살균제 톨프로카브(TPC)는 멜라닌 생합성 억제제이지만 다른 작용 방식을 가질 수도 있습니다.
살균제 톨프로카브(TPC)는 멜라닌 생합성 억제제이지만 다른 작용 방식을 가질 수도 있습니다.
Full Text
Although various melanin biosynthesis inhibitors have been developed, their efficacy and long-term safety needs to be further improved, and thus the goal of this study is to develop promising natural compound inhibitors of melanin biosynthesis.
다양한 멜라닌 생합성 억제제가 개발되고 있지만, 이들의 효능 및 장기적 안전성은 더욱 개선되어야 하므로 본 연구의 목적은 유망한 천연 멜라닌 생합성 억제제를 개발하는 것이다.
다양한 멜라닌 생합성 억제제가 개발되고 있지만, 이들의 효능 및 장기적 안전성은 더욱 개선되어야 하므로 본 연구의 목적은 유망한 천연 멜라닌 생합성 억제제를 개발하는 것이다.
Full Text
In the present study an acidified methanol pistachio hull extract was investigated for antioxidant and inhibitory effects on melanin biosynthesis by in vitro and in vivo assays.
본 연구에서는 산성화된 메탄올 피스타치오 껍질 추출물을 시험관 내 및 생체 내 분석을 통해 멜라닌 생합성에 대한 항산화 및 억제 효과에 대해 조사했습니다.
본 연구에서는 산성화된 메탄올 피스타치오 껍질 추출물을 시험관 내 및 생체 내 분석을 통해 멜라닌 생합성에 대한 항산화 및 억제 효과에 대해 조사했습니다.
Full Text
longipes in the skin, and we characterized its inhibitory effects on melanin biosynthesis.
피부에서 longipes, 그리고 우리는 멜라닌 생합성에 대한 억제 효과를 특성화했습니다.
피부에서 longipes, 그리고 우리는 멜라닌 생합성에 대한 억제 효과를 특성화했습니다.
Full Text
These DEGs were enriched in melanin biosynthesis and play a critical role in melanogenesis pathway.
이러한 DEG는 멜라닌 생합성이 풍부하고 멜라닌 생성 경로에서 중요한 역할을 합니다.
이러한 DEG는 멜라닌 생합성이 풍부하고 멜라닌 생성 경로에서 중요한 역할을 합니다.
Full Text
Tyrosinase enzymes can darken the skin color due to their activity against melanin biosynthesis.
티로시나제 효소는 멜라닌 생합성에 대한 활성으로 인해 피부색을 어둡게 할 수 있습니다.
티로시나제 효소는 멜라닌 생합성에 대한 활성으로 인해 피부색을 어둡게 할 수 있습니다.
Full Text
A specific inhibitor of melanin biosynthesis is tricyclazole.
멜라닌 생합성의 특정 억제제는 트리시클라졸입니다.
멜라닌 생합성의 특정 억제제는 트리시클라졸입니다.
Full Text
Thirteen PKS, 5 NRPS, and 4 PKS-NRPS hybrids were identified and characterized with functions including swainsonine and melanin biosynthesis.
13개의 PKS, 5개의 NRPS 및 4개의 PKS-NRPS 하이브리드가 확인되고 스웨인소닌 및 멜라닌 생합성을 포함한 기능으로 특성화되었습니다.
13개의 PKS, 5개의 NRPS 및 4개의 PKS-NRPS 하이브리드가 확인되고 스웨인소닌 및 멜라닌 생합성을 포함한 기능으로 특성화되었습니다.
Full Text
The tyrosinase is the main enzyme involved in melanin biosynthesis.
티로시나제는 멜라닌 생합성에 관여하는 주요 효소입니다.
티로시나제는 멜라닌 생합성에 관여하는 주요 효소입니다.
Full Text
Thus, melanin biosynthesis is not related to photosynthetic processes directly but may be dependent on the presence of plastids with well-developed internal membranes.
따라서 멜라닌 생합성은 광합성 과정과 직접적인 관련이 없지만 잘 발달된 내부 막이 있는 색소체의 존재에 의존할 수 있습니다.
따라서 멜라닌 생합성은 광합성 과정과 직접적인 관련이 없지만 잘 발달된 내부 막이 있는 색소체의 존재에 의존할 수 있습니다.
Full Text
Many genes responsible for melanin biosynthesis in fungi were physically linked together.
곰팡이에서 멜라닌 생합성을 담당하는 많은 유전자가 물리적으로 연결되어 있습니다.
곰팡이에서 멜라닌 생합성을 담당하는 많은 유전자가 물리적으로 연결되어 있습니다.
Full Text
Background and purpose: Tyrosinase enzyme has a key role in melanin biosynthesis by converting tyrosine into dopaquinone.
배경 및 목적: 티로시나아제 효소는 티로신을 도파퀴논으로 전환시켜 멜라닌 생합성에 중요한 역할을 합니다.
배경 및 목적: 티로시나아제 효소는 티로신을 도파퀴논으로 전환시켜 멜라닌 생합성에 중요한 역할을 합니다.
Full Text
Based on iTRAQ data, DEPs in the ΔCh-MEL1 mutant were mainly associated with melanin biosynthesis, carbohydrate and energy metabolism, lipid metabolism, redox processes, and amino acid metabolism.
iTRAQ 데이터에 따르면 ΔCh-MEL1 돌연변이의 DEP는 주로 멜라닌 생합성, 탄수화물 및 에너지 대사, 지질 대사, 산화환원 과정 및 아미노산 대사와 관련이 있었습니다.
iTRAQ 데이터에 따르면 ΔCh-MEL1 돌연변이의 DEP는 주로 멜라닌 생합성, 탄수화물 및 에너지 대사, 지질 대사, 산화환원 과정 및 아미노산 대사와 관련이 있었습니다.
Full Text
Tyrosinase plays an essential role in melanin biosynthesis and inherently exhibits both monophenolase and diphenolase activity.
티로시나아제는 멜라닌 생합성에 필수적인 역할을 하며 본질적으로 모노페놀라아제와 디페놀라아제 활성을 모두 나타냅니다.
티로시나아제는 멜라닌 생합성에 필수적인 역할을 하며 본질적으로 모노페놀라아제와 디페놀라아제 활성을 모두 나타냅니다.
Full Text
Tyrosinase is a copper-containing metalloenzyme that is responsible for the rate-limiting catalytic step in the melanin biosynthesis and enzymatic browning.
티로시나아제는 멜라닌 생합성 및 효소적 갈변에서 속도 제한 촉매 단계를 담당하는 구리 함유 금속효소입니다.
티로시나아제는 멜라닌 생합성 및 효소적 갈변에서 속도 제한 촉매 단계를 담당하는 구리 함유 금속효소입니다.
Full Text
Skin pigmentation can occur due to increased melanin, including melanocyte proliferation, melanin biosynthesis, or melanocyte migration.
피부 색소 침착은 멜라닌 세포 증식, 멜라닌 생합성 또는 멜라닌 세포 이동을 포함한 멜라닌 증가로 인해 발생할 수 있습니다.
피부 색소 침착은 멜라닌 세포 증식, 멜라닌 생합성 또는 멜라닌 세포 이동을 포함한 멜라닌 증가로 인해 발생할 수 있습니다.
Full Text
Tyrosinase-related protein-1 (TYRP-1) is an enzyme that plays an essential role in melanin biosynthesis, which occurs in the pigmented cells of the skin and the eye.
Tyrosinase-related protein-1(TYRP-1)은 피부와 눈의 색소 세포에서 발생하는 멜라닌 생합성에 필수적인 역할을 하는 효소입니다.
Tyrosinase-related protein-1(TYRP-1)은 피부와 눈의 색소 세포에서 발생하는 멜라닌 생합성에 필수적인 역할을 하는 효소입니다.
Full Text
1), a critical enzyme participating in melanogenesis, catalyzes the first two steps in melanin biosynthesis including the ortho-hydroxylation of L-tyrosine and the oxidation of L-DOPA.
1) 멜라닌 생성에 참여하는 중요한 효소인 L-티로신의 오르토-하이드록실화 및 L-DOPA의 산화를 포함하는 멜라닌 생합성의 처음 두 단계를 촉매합니다.
1) 멜라닌 생성에 참여하는 중요한 효소인 L-티로신의 오르토-하이드록실화 및 L-DOPA의 산화를 포함하는 멜라닌 생합성의 처음 두 단계를 촉매합니다.
Full Text
Tyrosinase plays an important role in melanin biosynthesis and enzymatic browning of fresh-cut fruit and vegetables.
Tyrosinase는 멜라닌 생합성과 신선하게 자른 과일과 채소의 효소적 갈변에 중요한 역할을 합니다.
Tyrosinase는 멜라닌 생합성과 신선하게 자른 과일과 채소의 효소적 갈변에 중요한 역할을 합니다.
Full Text
Differences in growth yield and melanin biosynthesis between the two populations grown under 2% NaCl stress suggested that this genomic island contributes to the observed differences in melanin accumulation.
2% NaCl 스트레스 하에 성장한 두 개체군 사이의 성장 수율 및 멜라닌 생합성의 차이는 이 게놈 섬이 관찰된 멜라닌 축적의 차이에 기여함을 시사했습니다.
2% NaCl 스트레스 하에 성장한 두 개체군 사이의 성장 수율 및 멜라닌 생합성의 차이는 이 게놈 섬이 관찰된 멜라닌 축적의 차이에 기여함을 시사했습니다.
Full Text
Consistent with these findings, we observed that the genes involved in melanin biosynthesis and the fungal hydrophobin MoMPG1 were remarkably suppressed in mycelia treated with 8 μM of sanguinarine.
이러한 발견과 일치하게, 우리는 멜라닌 생합성과 곰팡이 하이드로포빈 MoMPG1에 관여하는 유전자가 8 μM의 sanguinarine으로 처리된 균사체에서 현저하게 억제됨을 관찰했습니다.
이러한 발견과 일치하게, 우리는 멜라닌 생합성과 곰팡이 하이드로포빈 MoMPG1에 관여하는 유전자가 8 μM의 sanguinarine으로 처리된 균사체에서 현저하게 억제됨을 관찰했습니다.
Full Text
In addition, gene annotation revealed that Cla019481 encoded a polyphenol oxidase (PPO), which involved in the oxidation step of the melanin biosynthesis.
또한, 유전자 주석은 Cla019481이 멜라닌 생합성의 산화 단계에 관여하는 폴리페놀 산화효소(PPO)를 암호화하는 것으로 밝혀졌습니다.
또한, 유전자 주석은 Cla019481이 멜라닌 생합성의 산화 단계에 관여하는 폴리페놀 산화효소(PPO)를 암호화하는 것으로 밝혀졌습니다.
Full Text
solani AG1-IA were involved in secondary metabolite biosynthesis, melanin biosynthesis, ubiquitin processes, autophagy, and reactive oxygen species metabolism.
solani AG1-IA는 2차 대사산물 생합성, 멜라닌 생합성, 유비퀴틴 과정, 자가포식 및 활성산소종 대사에 관여했습니다.
solani AG1-IA는 2차 대사산물 생합성, 멜라닌 생합성, 유비퀴틴 과정, 자가포식 및 활성산소종 대사에 관여했습니다.
Full Text
Although the etiopathogenesis is not fully known, tyrosine is thought to be responsible for the pathogenesis of enzyme hyperactivity in melanin biosynthesis.
병인 발생은 완전히 알려져 있지 않지만 티로신은 멜라닌 생합성에서 효소 과잉 활성의 병인을 담당하는 것으로 생각됩니다.
병인 발생은 완전히 알려져 있지 않지만 티로신은 멜라닌 생합성에서 효소 과잉 활성의 병인을 담당하는 것으로 생각됩니다.
Full Text
dahliae Ssk2) and ΔVdSte11 strains showed severe defects in microsclerotial formation and melanin biosynthesis, but the relative importance of these two genes in microsclerotial development was different.
dahliae Ssk2) 및 ΔVdSte11 균주는 미세 공막 형성 및 멜라닌 생합성에서 심각한 결함을 나타내었지만 미세 공막 발달에서 이 두 유전자의 상대적 중요성은 달랐습니다.
dahliae Ssk2) 및 ΔVdSte11 균주는 미세 공막 형성 및 멜라닌 생합성에서 심각한 결함을 나타내었지만 미세 공막 발달에서 이 두 유전자의 상대적 중요성은 달랐습니다.
Full Text
Tyrosinase enzyme plays a crucial role in melanin biosynthesis and enzymatic browning process of vegetables and fruits.
Tyrosinase 효소는 야채와 과일의 멜라닌 생합성과 효소적 갈변 과정에 중요한 역할을 합니다.
Tyrosinase 효소는 야채와 과일의 멜라닌 생합성과 효소적 갈변 과정에 중요한 역할을 합니다.
Full Text
The TYR gene encodes tyrosinase, a multifunctional enzyme that is essential for melanin biosynthesis in melanocytes.
TYR 유전자는 멜라닌 세포에서 멜라닌 생합성에 필수적인 다기능 효소인 티로시나아제를 암호화합니다.
TYR 유전자는 멜라닌 세포에서 멜라닌 생합성에 필수적인 다기능 효소인 티로시나아제를 암호화합니다.
Full Text
Oculocutaneous albinism is an autosomal recessive disease caused by the complete absence or decrease of melanin biosynthesis in melanocytes.
눈 피부 백색증은 멜라닌 세포에서 멜라닌 생합성의 완전한 부재 또는 감소로 인해 발생하는 상염색체 열성 질환입니다.
눈 피부 백색증은 멜라닌 세포에서 멜라닌 생합성의 완전한 부재 또는 감소로 인해 발생하는 상염색체 열성 질환입니다.
Full Text
Tyrosinases are melanocyte‐specific enzymes involved in melanin biosynthesis.
티로시나제는 멜라닌 생합성에 관여하는 멜라닌 세포 특이적 효소입니다.
티로시나제는 멜라닌 생합성에 관여하는 멜라닌 세포 특이적 효소입니다.
Full Text
Tyrosinase plays an important role in melanin biosynthesis and protects skin against ultraviolet radiations.
Tyrosinase는 멜라닌 생합성에 중요한 역할을 하며 자외선으로부터 피부를 보호합니다.
Tyrosinase는 멜라닌 생합성에 중요한 역할을 하며 자외선으로부터 피부를 보호합니다.
Full Text
Finally, typical virulence factors including melanin biosynthesis and capsule formation in flc1Δ mutant were reduced as well, indicating the possible involvement of Flc1 in virulence.
마지막으로, flc1Δ 돌연변이체에서 멜라닌 생합성 및 캡슐 형성을 포함한 전형적인 독성 인자도 감소되어 독성에 Flc1이 관여할 수 있음을 나타냅니다.
마지막으로, flc1Δ 돌연변이체에서 멜라닌 생합성 및 캡슐 형성을 포함한 전형적인 독성 인자도 감소되어 독성에 Flc1이 관여할 수 있음을 나타냅니다.
Full Text
We discuss the relationships between PKC and melanin biosynthesis.
우리는 PKC와 멜라닌 생합성 사이의 관계에 대해 논의합니다.
우리는 PKC와 멜라닌 생합성 사이의 관계에 대해 논의합니다.
Full Text
The genomes of melanin-producing 303 and 299 each contain two copies of the gene encoding tyrosinase (melC2 and melD2), an enzyme necessary for melanin biosynthesis in Streptomyces.
멜라닌 생성 303과 299의 게놈은 각각 스트렙토마이세스에서 멜라닌 생합성에 필요한 효소인 티로시나제(melC2 및 melD2)를 코딩하는 유전자의 두 복사본을 포함합니다.
멜라닌 생성 303과 299의 게놈은 각각 스트렙토마이세스에서 멜라닌 생합성에 필요한 효소인 티로시나제(melC2 및 melD2)를 코딩하는 유전자의 두 복사본을 포함합니다.
Full Text
Oculocutaneous albinism is an autosomal recessive disorder characterized by either a complete lack of or reduction in melanin biosynthesis in the skin, hair, and eyes.
눈 피부 백색증은 피부, 모발 및 눈에서 멜라닌 생합성의 완전한 결핍 또는 감소를 특징으로 하는 상염색체 열성 장애입니다.
눈 피부 백색증은 피부, 모발 및 눈에서 멜라닌 생합성의 완전한 결핍 또는 감소를 특징으로 하는 상염색체 열성 장애입니다.
Full Text
The melanosomal protein Pmel17 forms amyloid in vivo and contains a highly amyloidogenic Repeat domain (RPT), important for melanin biosynthesis.
멜라노솜 단백질 Pmel17은 생체 내에서 아밀로이드를 형성하고 멜라닌 생합성에 중요한 고도로 아밀로이드 생성 반복 도메인(RPT)을 포함합니다.
멜라노솜 단백질 Pmel17은 생체 내에서 아밀로이드를 형성하고 멜라닌 생합성에 중요한 고도로 아밀로이드 생성 반복 도메인(RPT)을 포함합니다.
Full Text
In Pseudomonas aeruginosa, the enzyme 4‑hydroxyphenylpiruvate dioxygenase (Hpd) converts 4-hydroxyphenylpiruvate into homogentisic acid, which represents the key intermediate for melanin biosynthesis.
녹농균(Pseudomonas aeruginosa)에서 효소 4-하이드록시페닐피루베이트 디옥시게나제(Hpd)는 4-하이드록시페닐피루베이트를 멜라닌 생합성의 핵심 중간체를 나타내는 호모젠티스산으로 전환합니다.
녹농균(Pseudomonas aeruginosa)에서 효소 4-하이드록시페닐피루베이트 디옥시게나제(Hpd)는 4-하이드록시페닐피루베이트를 멜라닌 생합성의 핵심 중간체를 나타내는 호모젠티스산으로 전환합니다.
Full Text
Among the identified DEGs and DEPs, genes related to carotenoids biosynthesis including apolipophorin, and Cytochrome P450 and those related to melanin biosynthesis including tyrosinase and Ras-related protein Rab-11A were found to express at higher levels in orange adductor muscles.
확인된 DEG와 DEP 중 apolipophorin, Cytochrome P450을 포함한 carotenoid 생합성 관련 유전자와 tyrosinase, Ras 관련 단백질 Rab-11A 등 멜라닌 생합성 관련 유전자는 오렌지 내전근에서 더 높은 수준으로 발현되는 것으로 밝혀졌다.
확인된 DEG와 DEP 중 apolipophorin, Cytochrome P450을 포함한 carotenoid 생합성 관련 유전자와 tyrosinase, Ras 관련 단백질 Rab-11A 등 멜라닌 생합성 관련 유전자는 오렌지 내전근에서 더 높은 수준으로 발현되는 것으로 밝혀졌다.
Full Text
Multidisciplinary studies have been conducted to elucidate the correlation between coloration and melanin biosynthesis (referred as melanogenesis).
착색과 멜라닌 생합성(멜라닌 생성이라고 함) 사이의 상관관계를 밝히기 위해 학제간 연구가 수행되었습니다.
착색과 멜라닌 생합성(멜라닌 생성이라고 함) 사이의 상관관계를 밝히기 위해 학제간 연구가 수행되었습니다.
Full Text
Tyrosinase, a copper-containing protein, is the rate-limiting enzyme in melanin biosynthesis and first catalyzes the hydroxylation of l-tyrosine to 3,4-dihydroxyphenylalanine (DOPA) and the further oxidization to dopaquinone.
구리 함유 단백질인 티로시나제는 멜라닌 생합성에서 속도 제한 효소이며 먼저 1-티로신의 3,4-디히드록시페닐알라닌(DOPA)으로의 수산화 및 도파퀴논으로의 추가 산화를 촉매합니다.
구리 함유 단백질인 티로시나제는 멜라닌 생합성에서 속도 제한 효소이며 먼저 1-티로신의 3,4-디히드록시페닐알라닌(DOPA)으로의 수산화 및 도파퀴논으로의 추가 산화를 촉매합니다.
Full Text
Inhibition of tyrosinase activity, a core component in melanin biosynthesis, is one of the mechanisms of depigmenting agents.
멜라닌 생합성의 핵심 성분인 티로시나아제 활성의 억제는 탈색제의 메커니즘 중 하나입니다.
멜라닌 생합성의 핵심 성분인 티로시나아제 활성의 억제는 탈색제의 메커니즘 중 하나입니다.
Full Text
Introduction: Oculocutaneous albinism is an autosomal recessive disease caused by complete absence of or decrease in melanin biosynthesis in melanocytes.
서론: 피부 안백색증은 멜라닌 세포에서 멜라닌 생합성이 완전히 없거나 감소하여 발생하는 상염색체 열성 질환입니다.
서론: 피부 안백색증은 멜라닌 세포에서 멜라닌 생합성이 완전히 없거나 감소하여 발생하는 상염색체 열성 질환입니다.
Full Text
Since yellow is critical for melanin biosynthesis (Heinze et al.
노란색은 멜라닌 생합성에 중요하기 때문에(Heinze et al.
노란색은 멜라닌 생합성에 중요하기 때문에(Heinze et al.
Full Text
The melanin-specific transcriptional activator Cmr1 encoded by the CMR1 gene was specifically bound to the promoter with the sequence TTCTCTCCA of the PKS1 gene and strongly stimulated expression of the PKS1 gene and any other genes responsible for melanin biosynthesis, so that a large amount of melanin could be produced by A.
CMR1 유전자에 의해 암호화된 멜라닌 특이적 전사 활성인자 Cmr1은 PKS1 유전자의 서열 TTCTCTCCA를 갖는 프로모터에 특이적으로 결합되어 PKS1 유전자 및 멜라닌 생합성을 담당하는 다른 모든 유전자의 발현을 강력하게 자극하여 다량의 멜라닌 A가 생산할 수 있다.
CMR1 유전자에 의해 암호화된 멜라닌 특이적 전사 활성인자 Cmr1은 PKS1 유전자의 서열 TTCTCTCCA를 갖는 프로모터에 특이적으로 결합되어 PKS1 유전자 및 멜라닌 생합성을 담당하는 다른 모든 유전자의 발현을 강력하게 자극하여 다량의 멜라닌 A가 생산할 수 있다.
Full Text
Using reported inhibitors of DHN-melanin (tricyclazole and phthalide) and DOPA-melanin (tropolone and kojic acid) pathways on a set of conidial color mutants, we investigated the involvement of melanin biosynthesis in A.
분생자 색상 돌연변이 세트에서 DHN-멜라닌(트리시클라졸 및 프탈라이드) 및 DOPA-멜라닌(트로폴론 및 코직산) 경로의 보고된 억제제를 사용하여 A.에서 멜라닌 생합성의 관련성을 조사했습니다.
분생자 색상 돌연변이 세트에서 DHN-멜라닌(트리시클라졸 및 프탈라이드) 및 DOPA-멜라닌(트로폴론 및 코직산) 경로의 보고된 억제제를 사용하여 A.에서 멜라닌 생합성의 관련성을 조사했습니다.
Full Text
Various Genome Wide Association Studies (GWAS) have shown the association of different genomic variants with normal human skin pigmentation, often indicating genes with no direct implications in melanin biosynthesis or distribution.
다양한 Genome Wide Association Studies(GWAS)는 다양한 게놈 변이체와 정상적인 인간 피부 색소 침착의 연관성을 보여주었으며, 종종 멜라닌 생합성 또는 분포에 직접적인 영향을 미치지 않는 유전자를 나타냅니다.
다양한 Genome Wide Association Studies(GWAS)는 다양한 게놈 변이체와 정상적인 인간 피부 색소 침착의 연관성을 보여주었으며, 종종 멜라닌 생합성 또는 분포에 직접적인 영향을 미치지 않는 유전자를 나타냅니다.
Full Text
Furthermore, disruption of VdSsk1 resulted in significant downregulation of melanin biosynthesis-related genes but did not affect microsclerotial development.
또한, VdSsk1의 파괴는 멜라닌 생합성 관련 유전자의 상당한 하향 조절을 초래했지만 미세 공막 발달에는 영향을 미치지 않았습니다.
또한, VdSsk1의 파괴는 멜라닌 생합성 관련 유전자의 상당한 하향 조절을 초래했지만 미세 공막 발달에는 영향을 미치지 않았습니다.
Full Text
Functional analysis suggested that the differentially expressed transcripts are involved in biological processes such as melanin biosynthesis, pigmentation and tyrosine metabolism.
기능 분석은 차등적으로 발현된 전사체가 멜라닌 생합성, 색소 침착 및 티로신 대사와 같은 생물학적 과정에 관여한다는 것을 시사했습니다.
기능 분석은 차등적으로 발현된 전사체가 멜라닌 생합성, 색소 침착 및 티로신 대사와 같은 생물학적 과정에 관여한다는 것을 시사했습니다.
Full Text
Phenoloxidase (PO) plays a key role in melanin biosynthesis during insect development.
Phenoloxidase(PO)는 곤충 발달 동안 멜라닌 생합성에서 중요한 역할을 합니다.
Phenoloxidase(PO)는 곤충 발달 동안 멜라닌 생합성에서 중요한 역할을 합니다.
Full Text
The most important biological activities of Artemisia's alkaloids are including hepatoprotective, local anesthetic, β‐galactosidase, and antiparasitic activities; treatment of angina pectoris, opening blocked arteries, as a sleep‐inducing agents and inhibition of HIV viral protease, CYP450, melanin biosynthesis, human carbonic anhydrase, [3H]‐AEA metabolism, kinases, and DNA polymerase β1.
쑥 알칼로이드의 가장 중요한 생물학적 활성은 간 보호, 국소 마취제, β-갈락토시다아제 및 구충 활성을 포함합니다. 협심증 치료, 차단된 동맥 개방, 수면 유도제 및 HIV 바이러스 프로테아제, CYP450, 멜라닌 생합성, 인간 탄산 탈수효소, [3H]-AEA 대사, 키나아제 및 DNA 중합효소 β1의 억제.
쑥 알칼로이드의 가장 중요한 생물학적 활성은 간 보호, 국소 마취제, β-갈락토시다아제 및 구충 활성을 포함합니다. 협심증 치료, 차단된 동맥 개방, 수면 유도제 및 HIV 바이러스 프로테아제, CYP450, 멜라닌 생합성, 인간 탄산 탈수효소, [3H]-AEA 대사, 키나아제 및 DNA 중합효소 β1의 억제.
Full Text
As predicted, the expression of Mc1r and 18 additional genes associated with melanin biosynthesis was significantly downregulated in the skin tissue of O.
예상대로 멜라닌 생합성과 관련된 Mc1r 및 18개의 추가 유전자의 발현은 O의 피부 조직에서 유의하게 하향조절되었다.
예상대로 멜라닌 생합성과 관련된 Mc1r 및 18개의 추가 유전자의 발현은 O의 피부 조직에서 유의하게 하향조절되었다.
Full Text
The gene encoding scytalone dehydratase was used as the target so that mutants can be readily distinguished owning to a lack of melanin biosynthesis.
scytalone dehydratase를 코딩하는 유전자를 표적으로 사용하여 멜라닌 생합성이 결여되어 돌연변이를 쉽게 구별할 수 있습니다.
scytalone dehydratase를 코딩하는 유전자를 표적으로 사용하여 멜라닌 생합성이 결여되어 돌연변이를 쉽게 구별할 수 있습니다.
Full Text
Polyphenol oxidase (Tyrosinase, PPO) has received considerable attention, since it is the key enzyme in melanin biosynthesis.
폴리페놀 산화효소(Tyrosinase, PPO)는 멜라닌 생합성의 핵심 효소이기 때문에 상당한 주목을 받고 있습니다.
폴리페놀 산화효소(Tyrosinase, PPO)는 멜라닌 생합성의 핵심 효소이기 때문에 상당한 주목을 받고 있습니다.
Full Text
The process of melanin biosynthesis and its distribution throughout the skin is regulated by complex processes involving several enzymes in melanocytes.
멜라닌 생합성 과정과 피부 전체에 분포하는 멜라닌 세포는 멜라닌 세포의 여러 효소와 관련된 복잡한 과정에 의해 조절됩니다.
멜라닌 생합성 과정과 피부 전체에 분포하는 멜라닌 세포는 멜라닌 세포의 여러 효소와 관련된 복잡한 과정에 의해 조절됩니다.
Full Text
The enzyme tyrosinase plays a vital role in melanin biosynthesis and enzymatic browning of vegetables and fruits.
효소 티로시나아제는 멜라닌 생합성과 야채와 과일의 효소적 갈변에 중요한 역할을 합니다.
효소 티로시나아제는 멜라닌 생합성과 야채와 과일의 효소적 갈변에 중요한 역할을 합니다.