Biotechnology Information
생명 공학 정보
Sentence Examples
Discover more insights into Biotechnology Information 생명 공학 정보
Keywords frequently search together with Biotechnology Information 생명 공학 정보
Narrow sentence examples with built-in keyword filters
Biotechnology Information sentence examples within sequence read archive
These viral sequences were identified through homology searches in more than 3000 plant and insect transcriptomes from the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) using known plant rhabdovirus sequences as the query.
이러한 바이러스 서열은 알려진 식물 랍도바이러스 서열을 쿼리로 사용하여 NCBI(National Center for Biotechnology Information) SRA(Sequence Read Archive)의 3000개 이상의 식물 및 곤충 전사체에서 상동성 검색을 통해 확인되었습니다.
These viral sequences were identified through homology searches in more than 3000 plant and insect transcriptomes from the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) using known plant rhabdovirus sequences as the query.
이러한 바이러스 서열은 알려진 식물 랍도바이러스 서열을 쿼리로 사용하여 NCBI(National Center for Biotechnology Information) SRA(Sequence Read Archive)의 3000개 이상의 식물 및 곤충 전사체에서 상동성 검색을 통해 확인되었습니다.
Full Text
Sequence Read Archive submissions to the National Center for Biotechnology Information often lack useful metadata, which limits the utility of these submissions.
국립 생명 공학 정보 센터에 대한 시퀀스 읽기 아카이브 제출은 종종 유용한 메타 데이터가 부족하여 이러한 제출의 유용성을 제한합니다.
Sequence Read Archive submissions to the National Center for Biotechnology Information often lack useful metadata, which limits the utility of these submissions.
국립 생명 공학 정보 센터에 대한 시퀀스 읽기 아카이브 제출은 종종 유용한 메타 데이터가 부족하여 이러한 제출의 유용성을 제한합니다.
Full Text
Biotechnology Information sentence examples within se de uma
Metodo: Trata-se, de uma revisao bibliografica do metodo revisao integrativa da literatura, com abordagem qualitativa, realizado entre setembro de 2020 a fevereiro de 2021, por meio da busca de artigos indexados nas seguintes bases de dados: Scielo (Scientific Eletronic Library Online), BVS (Biblioteca Virtual em Saude), Google Scholar, PubMed (National Center for Biotechnology Information), Lilacs (Literatura Latino-Americana e do Caribe em Ciencias da Saude), Revistas de Enfermagem.
방법: Scielo(Scientific Electronic Library Online), VHL(Virtual Health) 데이터베이스에서 색인된 기사를 검색하여 2020년 9월과 2021년 2월 사이에 질적 접근 방식으로 통합 문헌 검토 방법에 대한 서지 검토입니다. Library), Google Scholar, PubMed(National Center for Biotechnology Information), Lilacs(건강 과학에 대한 라틴 아메리카 및 카리브해 문학), Nursing Journals.
Metodo: Trata-se, de uma revisao bibliografica do metodo revisao integrativa da literatura, com abordagem qualitativa, realizado entre setembro de 2020 a fevereiro de 2021, por meio da busca de artigos indexados nas seguintes bases de dados: Scielo (Scientific Eletronic Library Online), BVS (Biblioteca Virtual em Saude), Google Scholar, PubMed (National Center for Biotechnology Information), Lilacs (Literatura Latino-Americana e do Caribe em Ciencias da Saude), Revistas de Enfermagem.
방법: Scielo(Scientific Electronic Library Online), VHL(Virtual Health) 데이터베이스에서 색인된 기사를 검색하여 2020년 9월과 2021년 2월 사이에 질적 접근 방식으로 통합 문헌 검토 방법에 대한 서지 검토입니다. Library), Google Scholar, PubMed(National Center for Biotechnology Information), Lilacs(건강 과학에 대한 라틴 아메리카 및 카리브해 문학), Nursing Journals.
Full Text
Metodos: Trata-se, de uma revisao integrativa de literatura, realizado entre setembro de 2020 a marco de 2021, atraves da busca de artigos nas seguintes bases de dados: Scientific Eletronic Library Online (Scielo), Biblioteca Virtual em Saude (BVS), Google Scholar, National Center for Biotechnology Information (PubMed), Literatura Latino-Americana e do Caribe em Ciencias da Saude (Lilacs), Revistas de Enfermagem.
방법: 이것은 Scientific Electronic Library Online(Scielo), Biblioteca Virtual em Saude(BVS), Google Scholar, National Center for Biotechnology 데이터베이스에서 기사를 검색하여 2020년 9월에서 2021년 3월 사이에 수행된 통합 문헌 검토입니다. 정보(PubMed), 건강 과학의 라틴 아메리카 및 카리브해 문학(라일락), 간호 저널.
Metodos: Trata-se, de uma revisao integrativa de literatura, realizado entre setembro de 2020 a marco de 2021, atraves da busca de artigos nas seguintes bases de dados: Scientific Eletronic Library Online (Scielo), Biblioteca Virtual em Saude (BVS), Google Scholar, National Center for Biotechnology Information (PubMed), Literatura Latino-Americana e do Caribe em Ciencias da Saude (Lilacs), Revistas de Enfermagem.
방법: 이것은 Scientific Electronic Library Online(Scielo), Biblioteca Virtual em Saude(BVS), Google Scholar, National Center for Biotechnology 데이터베이스에서 기사를 검색하여 2020년 9월에서 2021년 3월 사이에 수행된 통합 문헌 검토입니다. 정보(PubMed), 건강 과학의 라틴 아메리카 및 카리브해 문학(라일락), 간호 저널.
Full Text
Biotechnology Information sentence examples within revisao integrativa de
Trata-se, de um estudo de revisao integrativa de literatura, com abordagem qualitativa, realizado por meio da busca de artigos indexados nas seguintes bases de dados: Scientific Electronic Library Online (SCIELO), National Center for Biotechnology Information (PUBMED), Literatura Latino-Americana e do Caribe em Ciencias da Saude (LILACS).
이것은 다음 데이터베이스에서 색인된 기사를 검색하여 수행된 질적 접근 방식의 통합 문헌 검토 연구입니다. 건강 과학(LILACS).
Trata-se, de um estudo de revisao integrativa de literatura, com abordagem qualitativa, realizado por meio da busca de artigos indexados nas seguintes bases de dados: Scientific Electronic Library Online (SCIELO), National Center for Biotechnology Information (PUBMED), Literatura Latino-Americana e do Caribe em Ciencias da Saude (LILACS).
이것은 다음 데이터베이스에서 색인된 기사를 검색하여 수행된 질적 접근 방식의 통합 문헌 검토 연구입니다. 건강 과학(LILACS).
Full Text
Trata-se de um estudo descritivo, do tipo revisao integrativa de literatura, de carater qualitativo, realizado por meio da busca de artigos indexados na Biblioteca Virtual em Saude (BVS), com o auxilio das seguintes bases de dados: Scientific Electronic Library Online (SCIELO), National Center for Biotechnology Information (PUBMED), Literatura Latino-Americana e do Caribe em Ciencias da Saude (LILACS), Base de Dados de Enfermagem (BDENF), e Periodicos Eletronicos em Psicologia (PEPSIC).
이것은 다음 데이터베이스의 도움으로 가상 건강 도서관(BVS)에 색인된 기사를 검색하여 수행된 질적 성격의 통합 문헌 검토 유형의 기술 연구입니다. Scientific Electronic Library Online( SCIELO), 국립 생명 공학 정보 센터(PUBMED), 건강 과학의 라틴 아메리카 및 카리브해 문학(LILACS), 간호 데이터베이스(BDENF) 및 심리학의 전자 저널(PEPSIC).
Trata-se de um estudo descritivo, do tipo revisao integrativa de literatura, de carater qualitativo, realizado por meio da busca de artigos indexados na Biblioteca Virtual em Saude (BVS), com o auxilio das seguintes bases de dados: Scientific Electronic Library Online (SCIELO), National Center for Biotechnology Information (PUBMED), Literatura Latino-Americana e do Caribe em Ciencias da Saude (LILACS), Base de Dados de Enfermagem (BDENF), e Periodicos Eletronicos em Psicologia (PEPSIC).
이것은 다음 데이터베이스의 도움으로 가상 건강 도서관(BVS)에 색인된 기사를 검색하여 수행된 질적 성격의 통합 문헌 검토 유형의 기술 연구입니다. Scientific Electronic Library Online( SCIELO), 국립 생명 공학 정보 센터(PUBMED), 건강 과학의 라틴 아메리카 및 카리브해 문학(LILACS), 간호 데이터베이스(BDENF) 및 심리학의 전자 저널(PEPSIC).
Full Text
Learn more from Biotechnology Information 생명 공학 정보
Biotechnology Information sentence examples within artigos indexados na
O levantamento dos dados foi realizado entre os meses de janeiro a julho de 2021, mediante a busca de artigos indexados na Biblioteca Virtual em Saúde (BVS), e Scientific Electronic Library Online (SciELO), com o auxílio das seguintes bases de dados: PubMed (National Center for Biotechnology Information), Lilacs (Literatura Latino-Americana e do Caribe em Ciências da Saúde), Base de Dados de Enfermagem (BDENF).
데이터 수집은 2021년 1월과 7월 사이에 가상 건강 도서관(BVS) 및 과학 전자 도서관 온라인(SciELO)에서 색인된 기사를 검색하여 다음 데이터베이스를 사용하여 수행했습니다. PubMed(National Center for Biotechnology Information) , 라일락(건강 과학에 대한 라틴 아메리카 및 카리브해 문학), 간호 데이터베이스(BDENF).
O levantamento dos dados foi realizado entre os meses de janeiro a julho de 2021, mediante a busca de artigos indexados na Biblioteca Virtual em Saúde (BVS), e Scientific Electronic Library Online (SciELO), com o auxílio das seguintes bases de dados: PubMed (National Center for Biotechnology Information), Lilacs (Literatura Latino-Americana e do Caribe em Ciências da Saúde), Base de Dados de Enfermagem (BDENF).
데이터 수집은 2021년 1월과 7월 사이에 가상 건강 도서관(BVS) 및 과학 전자 도서관 온라인(SciELO)에서 색인된 기사를 검색하여 다음 데이터베이스를 사용하여 수행했습니다. PubMed(National Center for Biotechnology Information) , 라일락(건강 과학에 대한 라틴 아메리카 및 카리브해 문학), 간호 데이터베이스(BDENF).
Full Text
Biotechnology Information sentence examples within National Biotechnology Information
Thirdly, the search result is similar to DENTICLE HERRING, after the NCBI (National Biotechnology Information Center) searched this sequence.
셋째, NCBI(National Biotechnology Information Center)에서 이 시퀀스를 검색한 결과 검색 결과가 DENTICLE HERRING과 유사합니다.
Thirdly, the search result is similar to DENTICLE HERRING, after the NCBI (National Biotechnology Information Center) searched this sequence.
셋째, NCBI(National Biotechnology Information Center)에서 이 시퀀스를 검색한 결과 검색 결과가 DENTICLE HERRING과 유사합니다.
Full Text
Methods We obtained mRNAs', miRNAs', and lncRNAs' expression profiles in PCOS specimens and normal specimens from the National Biotechnology Information Gene Expression Comprehensive Center database.
방법 우리는 국립 생명 공학 정보 유전자 발현 종합 센터 데이터베이스에서 PCOS 표본 및 정상 표본에서 mRNAs', miRNAs' 및 lncRNAs의 발현 프로파일을 얻었습니다.
Methods We obtained mRNAs', miRNAs', and lncRNAs' expression profiles in PCOS specimens and normal specimens from the National Biotechnology Information Gene Expression Comprehensive Center database.
방법 우리는 국립 생명 공학 정보 유전자 발현 종합 센터 데이터베이스에서 PCOS 표본 및 정상 표본에서 mRNAs', miRNAs' 및 lncRNAs의 발현 프로파일을 얻었습니다.
Full Text
Biotechnology Information sentence examples within biotechnology information database
Methods We downloaded the gene expression profiles of 358 metastatic and 102 primary (nonmetastatic) CM samples from The Cancer Genome Atlas (TCGA) database as a training dataset and the GSE65904 dataset from the National Center for Biotechnology Information database as a validation dataset.
방법 우리는 TCGA(The Cancer Genome Atlas) 데이터베이스에서 358개의 전이성 및 102개의 1차(비전이성) CM 샘플의 유전자 발현 프로필을 교육 데이터 세트로 다운로드하고 GSE65904 데이터 세트를 국립 생명 공학 정보 센터 데이터베이스에서 검증 데이터 세트로 다운로드했습니다.
Methods We downloaded the gene expression profiles of 358 metastatic and 102 primary (nonmetastatic) CM samples from The Cancer Genome Atlas (TCGA) database as a training dataset and the GSE65904 dataset from the National Center for Biotechnology Information database as a validation dataset.
방법 우리는 TCGA(The Cancer Genome Atlas) 데이터베이스에서 358개의 전이성 및 102개의 1차(비전이성) CM 샘플의 유전자 발현 프로필을 교육 데이터 세트로 다운로드하고 GSE65904 데이터 세트를 국립 생명 공학 정보 센터 데이터베이스에서 검증 데이터 세트로 다운로드했습니다.
Full Text
Furthermore, searching in the National Center for Biotechnology Information database revealed predominant expression of Fam181a in mouse and human testes, implying that it may have essential roles in spermatogenesis.
또한, 국립 생명 공학 정보 센터 데이터베이스에서 검색한 결과 Fam181a가 마우스와 인간의 고환에서 우세하게 발현되어 정자 형성에 필수적인 역할을 할 수 있음을 시사했습니다.
Furthermore, searching in the National Center for Biotechnology Information database revealed predominant expression of Fam181a in mouse and human testes, implying that it may have essential roles in spermatogenesis.
또한, 국립 생명 공학 정보 센터 데이터베이스에서 검색한 결과 Fam181a가 마우스와 인간의 고환에서 우세하게 발현되어 정자 형성에 필수적인 역할을 할 수 있음을 시사했습니다.
Full Text
Biotechnology Information sentence examples within biotechnology information gene
Then, we downloaded the GSE44001 gene expression profile data from the National Center for Biotechnology Information Gene Expression Omnibus (validation dataset).
그런 다음 National Center for Biotechnology Information Gene Expression Omnibus(검증 데이터 세트)에서 GSE44001 유전자 발현 프로필 데이터를 다운로드했습니다.
Then, we downloaded the GSE44001 gene expression profile data from the National Center for Biotechnology Information Gene Expression Omnibus (validation dataset).
그런 다음 National Center for Biotechnology Information Gene Expression Omnibus(검증 데이터 세트)에서 GSE44001 유전자 발현 프로필 데이터를 다운로드했습니다.
Full Text
A public database from the National Center for Biotechnology Information Gene Expression Omnibus (NCBI GEO) was applied for external validation.
NCBI GEO(National Center for Biotechnology Information Gene Expression Omnibus)의 공개 데이터베이스가 외부 검증을 위해 적용되었습니다.
A public database from the National Center for Biotechnology Information Gene Expression Omnibus (NCBI GEO) was applied for external validation.
NCBI GEO(National Center for Biotechnology Information Gene Expression Omnibus)의 공개 데이터베이스가 외부 검증을 위해 적용되었습니다.
Full Text
Biotechnology Information sentence examples within biotechnology information center
Thirdly, the search result is similar to DENTICLE HERRING, after the NCBI (National Biotechnology Information Center) searched this sequence.
셋째, NCBI(National Biotechnology Information Center)에서 이 시퀀스를 검색한 결과 검색 결과가 DENTICLE HERRING과 유사합니다.
Thirdly, the search result is similar to DENTICLE HERRING, after the NCBI (National Biotechnology Information Center) searched this sequence.
셋째, NCBI(National Biotechnology Information Center)에서 이 시퀀스를 검색한 결과 검색 결과가 DENTICLE HERRING과 유사합니다.
Full Text
Thirdly, the search result is similar to DANIO RERIO, and even Timema, after the NCBI (National Biotechnology Information Center) searched this sequence [GGATGTCTATTGAGTGACAA].
셋째, NCBI(National Biotechnology Information Center)에서 [GGATGTCTATTGAGTGACAA] 시퀀스를 검색한 후 검색 결과가 DANIO RERIO 및 Timema와 유사합니다.
Thirdly, the search result is similar to DANIO RERIO, and even Timema, after the NCBI (National Biotechnology Information Center) searched this sequence [GGATGTCTATTGAGTGACAA].
셋째, NCBI(National Biotechnology Information Center)에서 [GGATGTCTATTGAGTGACAA] 시퀀스를 검색한 후 검색 결과가 DANIO RERIO 및 Timema와 유사합니다.
Full Text
Biotechnology Information sentence examples within biotechnology information sequence
The goal was to enable laboratories outside of the FDA internal network to (1) perform quality assessments of sequence data, (2) identify links between clinical isolates and positive food/environmental samples, including those at the National Center for Biotechnology Information sequence read archive ( https://www.
목표는 FDA 내부 네트워크 외부의 실험실에서 (1) 서열 데이터의 품질 평가를 수행하고, (2) 국립 생명 공학 정보 센터에 있는 것을 포함하여 임상 분리물과 양성 식품/환경 샘플 간의 연결을 식별할 수 있도록 하는 것이었습니다. (https://www.
The goal was to enable laboratories outside of the FDA internal network to (1) perform quality assessments of sequence data, (2) identify links between clinical isolates and positive food/environmental samples, including those at the National Center for Biotechnology Information sequence read archive ( https://www.
목표는 FDA 내부 네트워크 외부의 실험실에서 (1) 서열 데이터의 품질 평가를 수행하고, (2) 국립 생명 공학 정보 센터에 있는 것을 포함하여 임상 분리물과 양성 식품/환경 샘플 간의 연결을 식별할 수 있도록 하는 것이었습니다. (https://www.
Full Text
All of the strains sequenced and submitted to the National Center for Biotechnology Information Sequence Read Archive were analyzed to identify the variants in the rpoB gene.
rpoB 유전자의 변이를 확인하기 위해 시퀀싱되어 국립 생명 공학 정보 서열 읽기 아카이브 센터에 제출된 모든 균주를 분석했습니다.
All of the strains sequenced and submitted to the National Center for Biotechnology Information Sequence Read Archive were analyzed to identify the variants in the rpoB gene.
rpoB 유전자의 변이를 확인하기 위해 시퀀싱되어 국립 생명 공학 정보 서열 읽기 아카이브 센터에 제출된 모든 균주를 분석했습니다.
Full Text
Biotechnology Information sentence examples within biotechnology information often
Sequence Read Archive submissions to the National Center for Biotechnology Information often lack useful metadata, which limits the utility of these submissions.
국립 생명 공학 정보 센터에 대한 시퀀스 읽기 아카이브 제출은 종종 유용한 메타 데이터가 부족하여 이러한 제출의 유용성을 제한합니다.
Sequence Read Archive submissions to the National Center for Biotechnology Information often lack useful metadata, which limits the utility of these submissions.
국립 생명 공학 정보 센터에 대한 시퀀스 읽기 아카이브 제출은 종종 유용한 메타 데이터가 부족하여 이러한 제출의 유용성을 제한합니다.
Full Text
Sequence Read Archive submissions to the National Center for Biotechnology Information often lack useful metadata, which limits the utility of these submissions.
국립 생명 공학 정보 센터에 대한 시퀀스 읽기 아카이브 제출은 종종 유용한 메타 데이터가 부족하여 이러한 제출의 유용성을 제한합니다.
Sequence Read Archive submissions to the National Center for Biotechnology Information often lack useful metadata, which limits the utility of these submissions.
국립 생명 공학 정보 센터에 대한 시퀀스 읽기 아카이브 제출은 종종 유용한 메타 데이터가 부족하여 이러한 제출의 유용성을 제한합니다.
Full Text
Biotechnology Information sentence examples within biotechnology information pubmed
The purpose of this paper is to review the existing evidence about WM abnormalities in individuals at ultra-high risk of psychosis (UHR) with the use of diffusion tensor imaging (DTI) available from the National Center for Biotechnology Information PubMed (Medline) and Health Source: Nursing/Academic Edition databases.
이 문서의 목적은 국립 생명 공학 정보 센터 PubMed (Medline) 및 건강에서 사용할 수있는 확산 텐서 영상 (DTI)을 사용하여 정신병의 초고 위험 (UHR)에있는 개인의 WM 이상에 대한 기존 증거를 검토하는 것입니다. 출처: Nursing/Academic Edition 데이터베이스.
The purpose of this paper is to review the existing evidence about WM abnormalities in individuals at ultra-high risk of psychosis (UHR) with the use of diffusion tensor imaging (DTI) available from the National Center for Biotechnology Information PubMed (Medline) and Health Source: Nursing/Academic Edition databases.
이 문서의 목적은 국립 생명 공학 정보 센터 PubMed (Medline) 및 건강에서 사용할 수있는 확산 텐서 영상 (DTI)을 사용하여 정신병의 초고 위험 (UHR)에있는 개인의 WM 이상에 대한 기존 증거를 검토하는 것입니다. 출처: Nursing/Academic Edition 데이터베이스.
Full Text
The studies reviewed were chosen by utilizing key term searches of the National Center for Biotechnology Information PubMed library and qualitative factor analysis by study team investigators.
검토된 연구는 국립생명공학정보센터 PubMed 라이브러리의 키워드 검색과 연구팀 조사자의 정성적 요인 분석을 활용하여 선택되었습니다.
The studies reviewed were chosen by utilizing key term searches of the National Center for Biotechnology Information PubMed library and qualitative factor analysis by study team investigators.
검토된 연구는 국립생명공학정보센터 PubMed 라이브러리의 키워드 검색과 연구팀 조사자의 정성적 요인 분석을 활용하여 선택되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1094/PDIS-01-21-0126-PDN
The sequence of one representative isolate was uploaded to NCBI (National Center for Biotechnology Information) and analyzed with BLASTn in the Fusarium MLST database (https://fusarium.
대표적인 분리주 중 하나의 서열은 NCBI(National Center for Biotechnology Information)에 업로드되었고 Fusarium MLST 데이터베이스(https://fusarium.htm)에서 BLASTn으로 분석되었습니다.
The sequence of one representative isolate was uploaded to NCBI (National Center for Biotechnology Information) and analyzed with BLASTn in the Fusarium MLST database (https://fusarium.
대표적인 분리주 중 하나의 서열은 NCBI(National Center for Biotechnology Information)에 업로드되었고 Fusarium MLST 데이터베이스(https://fusarium.htm)에서 BLASTn으로 분석되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1021/acs.jafc.0c07356
We characterized 716 lipid species, for which the profiles revealed the National Center for Biotechnology Information-established organismal classification and unique plant tissue metabotypes.
우리는 716개 지질 종을 특성화했으며, 프로필은 국립 생명 공학 정보 센터에서 설정한 유기체 분류 및 고유한 식물 조직 대사형을 나타냅니다.
We characterized 716 lipid species, for which the profiles revealed the National Center for Biotechnology Information-established organismal classification and unique plant tissue metabotypes.
우리는 716개 지질 종을 특성화했으며, 프로필은 국립 생명 공학 정보 센터에서 설정한 유기체 분류 및 고유한 식물 조직 대사형을 나타냅니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1007/s00705-021-05067-1
All sequences isolated from the insect samples were more than 95% identical to the sequences from the alfalfa samples or to sequences from the National Center for Biotechnology Information (NCBI) reference database.
곤충 샘플에서 분리된 모든 서열은 알팔파 샘플의 서열 또는 NCBI(National Center for Biotechnology Information) 참조 데이터베이스의 서열과 95% 이상 동일했습니다.
All sequences isolated from the insect samples were more than 95% identical to the sequences from the alfalfa samples or to sequences from the National Center for Biotechnology Information (NCBI) reference database.
곤충 샘플에서 분리된 모든 서열은 알팔파 샘플의 서열 또는 NCBI(National Center for Biotechnology Information) 참조 데이터베이스의 서열과 95% 이상 동일했습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.3390/genes12010115
mendocina genomes available in the National Center for Biotechnology Information (NCBI) repository, both strains were placed within one of two well-defined phylogenetic clusters.
NCBI(National Center for Biotechnology Information) 리포지토리에서 사용할 수 있는 멘도시나 게놈에서 두 균주는 두 개의 잘 정의된 계통 발생 클러스터 중 하나에 배치되었습니다.
mendocina genomes available in the National Center for Biotechnology Information (NCBI) repository, both strains were placed within one of two well-defined phylogenetic clusters.
NCBI(National Center for Biotechnology Information) 리포지토리에서 사용할 수 있는 멘도시나 게놈에서 두 균주는 두 개의 잘 정의된 계통 발생 클러스터 중 하나에 배치되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1016/j.ecoenv.2021.112108
The accession code of 16S rRNA sequencing reads in the National Center for Biotechnology Information (NCBI) BioProject database: PRJNA660154.
16S rRNA 시퀀싱의 등록 코드는 NCBI(National Center for Biotechnology Information) BioProject 데이터베이스: PRJNA660154에서 읽습니다.
The accession code of 16S rRNA sequencing reads in the National Center for Biotechnology Information (NCBI) BioProject database: PRJNA660154.
16S rRNA 시퀀싱의 등록 코드는 NCBI(National Center for Biotechnology Information) BioProject 데이터베이스: PRJNA660154에서 읽습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.13057/biodiv/d221012
The results elucidated the close genetic relationship between Mekong delta dragon fruits and National Center for Biotechnology Information (NCBI) database.
그 결과 메콩 삼각주 용과와 국립생명공학정보센터(NCBI) 데이터베이스 간의 밀접한 유전적 관계가 밝혀졌다.
The results elucidated the close genetic relationship between Mekong delta dragon fruits and National Center for Biotechnology Information (NCBI) database.
그 결과 메콩 삼각주 용과와 국립생명공학정보센터(NCBI) 데이터베이스 간의 밀접한 유전적 관계가 밝혀졌다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1021/acs.jproteome.1c00156
A total of 4320 sequences of human and nonhuman coronaviruses was retrieved from the Global Initiative on Sharing All Influenza Data and the National Center for Biotechnology Information.
인간 및 비인간 코로나바이러스의 총 4320개 염기서열이 모든 인플루엔자 데이터 공유에 관한 글로벌 이니셔티브와 국립 생명공학 정보 센터에서 검색되었습니다.
A total of 4320 sequences of human and nonhuman coronaviruses was retrieved from the Global Initiative on Sharing All Influenza Data and the National Center for Biotechnology Information.
인간 및 비인간 코로나바이러스의 총 4320개 염기서열이 모든 인플루엔자 데이터 공유에 관한 글로벌 이니셔티브와 국립 생명공학 정보 센터에서 검색되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.3389/fdgth.2021.686720
Applying our methodology to LitCovid, a literature hub from the National Center for Biotechnology Information, we improved the breadth and depth of research topics by subdividing their pre-existing categories.
국립 생명 공학 정보 센터의 문헌 허브인 LitCovid에 방법론을 적용하여 기존 범주를 세분화하여 연구 주제의 폭과 깊이를 개선했습니다.
Applying our methodology to LitCovid, a literature hub from the National Center for Biotechnology Information, we improved the breadth and depth of research topics by subdividing their pre-existing categories.
국립 생명 공학 정보 센터의 문헌 허브인 LitCovid에 방법론을 적용하여 기존 범주를 세분화하여 연구 주제의 폭과 깊이를 개선했습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.25046/AJ060177
Basic local alignment search tool (BLAST) from the National Center for Biotechnology Information.
국립 생명 공학 정보 센터의 기본 로컬 정렬 검색 도구(BLAST).
Basic local alignment search tool (BLAST) from the National Center for Biotechnology Information.
국립 생명 공학 정보 센터의 기본 로컬 정렬 검색 도구(BLAST).
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1515/jbcpp-2020-0467
scabiei obtain various hosts from National Centre for Biotechnology Information (NCBI) data.
scabiei는 NCBI(National Center for Biotechnology Information) 데이터에서 다양한 숙주를 얻습니다.
scabiei obtain various hosts from National Centre for Biotechnology Information (NCBI) data.
scabiei는 NCBI(National Center for Biotechnology Information) 데이터에서 다양한 숙주를 얻습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1093/nar/gki062
In addition to maintaining the GenBank(R) nucleic acid sequence database, the National Center for Biotechnology Information (NCBI) provides data analysis and retrieval and resources that operate on the data in GenBank and a variety of other biological data made available through NCBI's Web site.
GenBank(R) 핵산 서열 데이터베이스를 유지하는 것 외에도 NCBI(National Center for Biotechnology Information)는 GenBank의 데이터와 NCBI의 웹 사이트를 통해 제공되는 다양한 기타 생물학적 데이터에서 작동하는 데이터 분석 및 검색 및 리소스를 제공합니다. .
In addition to maintaining the GenBank(R) nucleic acid sequence database, the National Center for Biotechnology Information (NCBI) provides data analysis and retrieval and resources that operate on the data in GenBank and a variety of other biological data made available through NCBI's Web site.
GenBank(R) 핵산 서열 데이터베이스를 유지하는 것 외에도 NCBI(National Center for Biotechnology Information)는 GenBank의 데이터와 NCBI의 웹 사이트를 통해 제공되는 다양한 기타 생물학적 데이터에서 작동하는 데이터 분석 및 검색 및 리소스를 제공합니다. .
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1093/bioinformatics/btaa1027
Summary We present NCBI-taxonomist—a command-line tool written in Python that collects and manages taxonomic data from the National Center for Biotechnology Information (NCBI).
요약 NCBI(National Center for Biotechnology Information)에서 분류 데이터를 수집하고 관리하는 Python으로 작성된 명령줄 도구인 NCBI-taxonomist를 소개합니다.
Summary We present NCBI-taxonomist—a command-line tool written in Python that collects and manages taxonomic data from the National Center for Biotechnology Information (NCBI).
요약 NCBI(National Center for Biotechnology Information)에서 분류 데이터를 수집하고 관리하는 Python으로 작성된 명령줄 도구인 NCBI-taxonomist를 소개합니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1093/ijnp/pyab034
Methods We searched various ADHD interventions from the MEDLINE and PubMed databases (National Center for Biotechnology Information) between January 1, 1980, and July 30, 2018.
방법 우리는 1980년 1월 1일부터 2018년 7월 30일 사이에 MEDLINE 및 PubMed 데이터베이스(National Center for Biotechnology Information)에서 다양한 ADHD 중재를 검색했습니다.
Methods We searched various ADHD interventions from the MEDLINE and PubMed databases (National Center for Biotechnology Information) between January 1, 1980, and July 30, 2018.
방법 우리는 1980년 1월 1일부터 2018년 7월 30일 사이에 MEDLINE 및 PubMed 데이터베이스(National Center for Biotechnology Information)에서 다양한 ADHD 중재를 검색했습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.21203/rs.3.rs-621237/v1
The sequences obtained were compared to Cryptosporidium sequences in the GenBank using NCBI’s (National Center for Biotechnology Information) online BLAST (Basic Local Alignment Search Tool) algorithmic program.
얻은 서열은 NCBI(National Center for Biotechnology Information) 온라인 BLAST(Basic Local Alignment Search Tool) 알고리즘 프로그램을 사용하여 GenBank의 크립토스포리디움 서열과 비교되었습니다.
The sequences obtained were compared to Cryptosporidium sequences in the GenBank using NCBI’s (National Center for Biotechnology Information) online BLAST (Basic Local Alignment Search Tool) algorithmic program.
얻은 서열은 NCBI(National Center for Biotechnology Information) 온라인 BLAST(Basic Local Alignment Search Tool) 알고리즘 프로그램을 사용하여 GenBank의 크립토스포리디움 서열과 비교되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1016/j.dib.2021.107271
The complete genome sequence data have been submitted to the National Center for Biotechnology Information (NCBI) and have been deposited at DDBJ/ENA/GenBank under the accession number CP068595.
전체 게놈 서열 데이터는 국립 생명공학 정보 센터(NCBI)에 제출되었으며 수탁 번호 CP068595로 DDBJ/ENA/GenBank에 기탁되었습니다.
The complete genome sequence data have been submitted to the National Center for Biotechnology Information (NCBI) and have been deposited at DDBJ/ENA/GenBank under the accession number CP068595.
전체 게놈 서열 데이터는 국립 생명공학 정보 센터(NCBI)에 제출되었으며 수탁 번호 CP068595로 DDBJ/ENA/GenBank에 기탁되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.2139/ssrn.3808477
All were at National Center for Biotechnology Information (NCBI).
모두 NCBI(National Center for Biotechnology Information)에 있었습니다.
All were at National Center for Biotechnology Information (NCBI).
모두 NCBI(National Center for Biotechnology Information)에 있었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1080/21678707.2021.1898370
Areas Covered: A literature search was conducted using the National Center for Biotechnology Information (NCBI) database at the U.
적용 영역: 미국 국립 생명공학 정보 센터(NCBI) 데이터베이스를 사용하여 문헌 검색을 수행했습니다.
Areas Covered: A literature search was conducted using the National Center for Biotechnology Information (NCBI) database at the U.
적용 영역: 미국 국립 생명공학 정보 센터(NCBI) 데이터베이스를 사용하여 문헌 검색을 수행했습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1094/PDIS-06-20-1219-PDN
, 2016) and Blastn at the National Center for Biotechnology Information (http://www.
, 2016) 및 국립 생명 공학 정보 센터의 Blastn (http://www.
, 2016) and Blastn at the National Center for Biotechnology Information (http://www.
, 2016) 및 국립 생명 공학 정보 센터의 Blastn (http://www.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1186/s12885-021-07886-6
The Args were collected from Deathbase, a database related to cell death, combined with the research results of GeneCards、National Center for Biotechnology Information (NCBI) databases and a lot of literature.
Args는 GeneCards, NCBI(National Center for Biotechnology Information) 데이터베이스 및 많은 문헌의 연구 결과와 결합하여 세포 사멸과 관련된 데이터베이스인 Deathbase에서 수집되었습니다.
The Args were collected from Deathbase, a database related to cell death, combined with the research results of GeneCards、National Center for Biotechnology Information (NCBI) databases and a lot of literature.
Args는 GeneCards, NCBI(National Center for Biotechnology Information) 데이터베이스 및 많은 문헌의 연구 결과와 결합하여 세포 사멸과 관련된 데이터베이스인 Deathbase에서 수집되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1101/2021.01.30.428723
Data summary Sequencing data have been deposited at the National Center for Biotechnology Information under BioProject number PRJNA692536.
데이터 요약 시퀀싱 데이터는 BioProject 번호 PRJNA692536으로 National Center for Biotechnology Information에 기탁되었습니다.
Data summary Sequencing data have been deposited at the National Center for Biotechnology Information under BioProject number PRJNA692536.
데이터 요약 시퀀싱 데이터는 BioProject 번호 PRJNA692536으로 National Center for Biotechnology Information에 기탁되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1186/s12920-021-00959-2
An accession number from the National Center for Biotechnology Information (NCBI) ClinVar database was retrieved for this novel LAMA2 mutation.
NCBI(National Center for Biotechnology Information) ClinVar 데이터베이스의 등록 번호가 이 새로운 LAMA2 돌연변이에 대해 검색되었습니다.
An accession number from the National Center for Biotechnology Information (NCBI) ClinVar database was retrieved for this novel LAMA2 mutation.
NCBI(National Center for Biotechnology Information) ClinVar 데이터베이스의 등록 번호가 이 새로운 LAMA2 돌연변이에 대해 검색되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.9734/ARRB/2021/V36I230341
The 16S rRNA gene for two of these isolates have been amplified using PCR and the product sequenced, analyzed and registered in the National Center for Biotechnology Information (NCBI) as UKMS1 and UKMS2 and the accession numbers KX960104.
이들 분리주 중 2개에 대한 16S rRNA 유전자는 PCR을 사용하여 증폭되었으며 산물은 서열 분석, 분석 및 UKMS1 및 UKMS2로 국립 생명공학 정보 센터(NCBI)에 등록되었으며 수탁 번호 KX960104입니다.
The 16S rRNA gene for two of these isolates have been amplified using PCR and the product sequenced, analyzed and registered in the National Center for Biotechnology Information (NCBI) as UKMS1 and UKMS2 and the accession numbers KX960104.
이들 분리주 중 2개에 대한 16S rRNA 유전자는 PCR을 사용하여 증폭되었으며 산물은 서열 분석, 분석 및 UKMS1 및 UKMS2로 국립 생명공학 정보 센터(NCBI)에 등록되었으며 수탁 번호 KX960104입니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.5376/CMB.2021.11.0001
Currently there are over 5 000 RNA-seq datasets in soybean plants publicly available at SRA database in the National Center for Biotechnology Information (NCBI).
현재 NCBI(National Center for Biotechnology Information)의 SRA 데이터베이스에서 공개적으로 사용할 수 있는 대두 식물의 RNA-seq 데이터 세트가 5,000개가 넘습니다.
Currently there are over 5 000 RNA-seq datasets in soybean plants publicly available at SRA database in the National Center for Biotechnology Information (NCBI).
현재 NCBI(National Center for Biotechnology Information)의 SRA 데이터베이스에서 공개적으로 사용할 수 있는 대두 식물의 RNA-seq 데이터 세트가 5,000개가 넘습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.17305/bjbms.2021.6016
In this study, we included 70 active SJIA and 55 healthy control patients from the National Center for Biotechnology Information to analyze for differentially expressed genes (DEGs) using R.
이 연구에서 우리는 R을 사용하여 차등 발현 유전자(DEG)를 분석하기 위해 국립 생명 공학 정보 센터의 70명의 활성 SJIA와 55명의 건강한 대조군 환자를 포함했습니다.
In this study, we included 70 active SJIA and 55 healthy control patients from the National Center for Biotechnology Information to analyze for differentially expressed genes (DEGs) using R.
이 연구에서 우리는 R을 사용하여 차등 발현 유전자(DEG)를 분석하기 위해 국립 생명 공학 정보 센터의 70명의 활성 SJIA와 55명의 건강한 대조군 환자를 포함했습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1016/j.imu.2020.100497
Methods The sequence of the MSX1 protein from Homo sapiens was retrieved in the FASTA format from the National Center for Biotechnology Information (NCBI).
방법 호모 사피엔스의 MSX1 단백질의 서열은 NCBI(National Center for Biotechnology Information)에서 FASTA 형식으로 검색되었습니다.
Methods The sequence of the MSX1 protein from Homo sapiens was retrieved in the FASTA format from the National Center for Biotechnology Information (NCBI).
방법 호모 사피엔스의 MSX1 단백질의 서열은 NCBI(National Center for Biotechnology Information)에서 FASTA 형식으로 검색되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.47853/FAS.2021.E18
The results showed that there were 16 Epinephelinae that have been compared to a gene bank (National Centre for Biotechnology Information, NCBI) in the sequence length of 623 base pairs.
그 결과 623 염기쌍의 염기서열 길이에서 유전자 은행(National Center for Biotechnology Information, NCBI)과 비교한 16개의 Epinephelinae가 있음을 보여주었다.
The results showed that there were 16 Epinephelinae that have been compared to a gene bank (National Centre for Biotechnology Information, NCBI) in the sequence length of 623 base pairs.
그 결과 623 염기쌍의 염기서열 길이에서 유전자 은행(National Center for Biotechnology Information, NCBI)과 비교한 16개의 Epinephelinae가 있음을 보여주었다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.53966/jofh.v1i1.2
Initial data collection to explore sponge types and types of plants rich in iron was done using data search portal NCBI (National Center for Biotechnology Information, USA) in the last five years starting from 2016/03/30 to 2021/03/28.
2016/03/30부터 2021/03/28까지 지난 5년간 데이터 검색 포털 NCBI(National Center for Biotechnology Information, USA)를 사용하여 해면 유형 및 철분이 풍부한 식물 유형을 탐색하기 위한 초기 데이터 수집이 수행되었습니다.
Initial data collection to explore sponge types and types of plants rich in iron was done using data search portal NCBI (National Center for Biotechnology Information, USA) in the last five years starting from 2016/03/30 to 2021/03/28.
2016/03/30부터 2021/03/28까지 지난 5년간 데이터 검색 포털 NCBI(National Center for Biotechnology Information, USA)를 사용하여 해면 유형 및 철분이 풍부한 식물 유형을 탐색하기 위한 초기 데이터 수집이 수행되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.32604/cmc.2021.017206
The relevant genome sequences were extracted from the National Center for Biotechnology Information (NCBI) virus database.
관련 게놈 서열은 NCBI(National Center for Biotechnology Information) 바이러스 데이터베이스에서 추출했습니다.
The relevant genome sequences were extracted from the National Center for Biotechnology Information (NCBI) virus database.
관련 게놈 서열은 NCBI(National Center for Biotechnology Information) 바이러스 데이터베이스에서 추출했습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1111/ddg.14413
soudanense in the NCBI database (National Center for Biotechnology Information in Bethesda, Maryland, USA) was obtained.
NCBI 데이터베이스(미국 메릴랜드주 베데스다에 있는 국립 생명공학 정보 센터)에서 soudanense를 얻었습니다.
soudanense in the NCBI database (National Center for Biotechnology Information in Bethesda, Maryland, USA) was obtained.
NCBI 데이터베이스(미국 메릴랜드주 베데스다에 있는 국립 생명공학 정보 센터)에서 soudanense를 얻었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1016/j.gene.2021.145533
METHODS
Research studies were retrieved from PubMed, Google Scholar, Science direct, and the National Center for Biotechnology Information (NCBI) database.
행동 양식
연구 연구는 PubMed, Google Scholar, Science direct 및 NCBI(National Center for Biotechnology Information) 데이터베이스에서 검색되었습니다.
METHODS
Research studies were retrieved from PubMed, Google Scholar, Science direct, and the National Center for Biotechnology Information (NCBI) database.
행동 양식 연구 연구는 PubMed, Google Scholar, Science direct 및 NCBI(National Center for Biotechnology Information) 데이터베이스에서 검색되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1186/s41938-021-00419-0
The sequence of the ITS was submitted to the National Center for Biotechnology Information (NCBI) and registered under accession no.
ITS의 서열은 NCBI(National Center for Biotechnology Information)에 제출되었으며 수탁 번호 2008로 등록되었습니다.
The sequence of the ITS was submitted to the National Center for Biotechnology Information (NCBI) and registered under accession no.
ITS의 서열은 NCBI(National Center for Biotechnology Information)에 제출되었으며 수탁 번호 2008로 등록되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.18517/IJASEIT.11.2.12973
The Internal Transcribed Spacer (ITS) region sequences of selected 280 medicinal plants taxa obtained from NCBI (National Center for Biotechnology Information) were aligned by MUSCLE multiple sequences alignments.
NCBI(National Center for Biotechnology Information)에서 얻은 선택된 280개의 약용 식물 분류군의 ITS(Internal Transcribed Spacer) 영역 서열은 MUSCLE 다중 서열 정렬에 의해 정렬되었습니다.
The Internal Transcribed Spacer (ITS) region sequences of selected 280 medicinal plants taxa obtained from NCBI (National Center for Biotechnology Information) were aligned by MUSCLE multiple sequences alignments.
NCBI(National Center for Biotechnology Information)에서 얻은 선택된 280개의 약용 식물 분류군의 ITS(Internal Transcribed Spacer) 영역 서열은 MUSCLE 다중 서열 정렬에 의해 정렬되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.3390/plants10020337
National Center for Biotechnology Information (NCBI) BLAST analyses of the obtained sequence revealed 100% identity of tested strain with deposited Ca.
NCBI(National Center for Biotechnology Information) BLAST 분석을 통해 얻은 염기서열을 분석한 결과 Ca가 축적된 시험 균주의 100% 동일성이 밝혀졌습니다.
National Center for Biotechnology Information (NCBI) BLAST analyses of the obtained sequence revealed 100% identity of tested strain with deposited Ca.
NCBI(National Center for Biotechnology Information) BLAST 분석을 통해 얻은 염기서열을 분석한 결과 Ca가 축적된 시험 균주의 100% 동일성이 밝혀졌습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1515/jbcpp-2020-0471
The computer softwares such as National Center for Biotechnology Information (NCBI) data base, Software Affymetrix, DNA Strider program, Genomatix – DiAlign program, Oligo 5.
NCBI(National Center for Biotechnology Information) 데이터베이스, Software Affymetrix, DNA Strider 프로그램, Genomatix – DiAlign 프로그램, Oligo 5와 같은 컴퓨터 소프트웨어.
The computer softwares such as National Center for Biotechnology Information (NCBI) data base, Software Affymetrix, DNA Strider program, Genomatix – DiAlign program, Oligo 5.
NCBI(National Center for Biotechnology Information) 데이터베이스, Software Affymetrix, DNA Strider 프로그램, Genomatix – DiAlign 프로그램, Oligo 5와 같은 컴퓨터 소프트웨어.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1016/j.dib.2021.106852
The raw sequencing reads and the assembled contigs/scaffolds are archived at the National Center for Biotechnology Information.
원시 시퀀싱 읽기 및 조립된 콘티그/스캐폴드는 국립 생명공학 정보 센터에 보관됩니다.
The raw sequencing reads and the assembled contigs/scaffolds are archived at the National Center for Biotechnology Information.
원시 시퀀싱 읽기 및 조립된 콘티그/스캐폴드는 국립 생명공학 정보 센터에 보관됩니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.21203/RS.3.RS-403172/V1
Forty putative genes of Leishmania donovani BPK282A1 genes were obtained from National Center for Biotechnology Information and investigated using bioinformatic tools, such as Neural Network Promoter Prediction, MEME suite, CpG island finder, GOMo and CLC Genomics Workbench.
Leishmania donovani BPK282A1 유전자의 추정 유전자 40개는 National Center for Biotechnology Information에서 얻었고 Neural Network Promoter Prediction, MEME suite, CpG Island finder, GOMo 및 CLC Genomics Workbench와 같은 생물정보학 도구를 사용하여 조사했습니다.
Forty putative genes of Leishmania donovani BPK282A1 genes were obtained from National Center for Biotechnology Information and investigated using bioinformatic tools, such as Neural Network Promoter Prediction, MEME suite, CpG island finder, GOMo and CLC Genomics Workbench.
Leishmania donovani BPK282A1 유전자의 추정 유전자 40개는 National Center for Biotechnology Information에서 얻었고 Neural Network Promoter Prediction, MEME suite, CpG Island finder, GOMo 및 CLC Genomics Workbench와 같은 생물정보학 도구를 사용하여 조사했습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1186/s41938-021-00425-2
The ITS sequences were submitted to the National Center for Biotechnology Information (NCBI) and registered under accession nos.
ITS 염기서열은 NCBI(National Center for Biotechnology Information)에 제출되었으며 수탁 번호로 등록되었습니다.
The ITS sequences were submitted to the National Center for Biotechnology Information (NCBI) and registered under accession nos.
ITS 염기서열은 NCBI(National Center for Biotechnology Information)에 제출되었으며 수탁 번호로 등록되었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.5812/ijcm.113121
National Center for Biotechnology Information (NCBI) was the main resource.
NCBI(National Center for Biotechnology Information)가 주요 자원이었습니다.
National Center for Biotechnology Information (NCBI) was the main resource.
NCBI(National Center for Biotechnology Information)가 주요 자원이었습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1093/database/baab029
In this study, we used bioinformatics methods and web tools such as UniProt, European Bioinformatics Institute, National Center for Biotechnology Information, Ensembl Genome Browser, Ensembl Bacteria, RSCB PDB and Pseudomonas Genome Database.
본 연구에서는 UniProt, European Bioinformatics Institute, National Center for Biotechnology Information, Ensembl Genome Browser, Ensembl Bacteria, RSCB PDB 및 Pseudomonas Genome Database와 같은 생물정보학 방법과 웹 도구를 사용했습니다.
In this study, we used bioinformatics methods and web tools such as UniProt, European Bioinformatics Institute, National Center for Biotechnology Information, Ensembl Genome Browser, Ensembl Bacteria, RSCB PDB and Pseudomonas Genome Database.
본 연구에서는 UniProt, European Bioinformatics Institute, National Center for Biotechnology Information, Ensembl Genome Browser, Ensembl Bacteria, RSCB PDB 및 Pseudomonas Genome Database와 같은 생물정보학 방법과 웹 도구를 사용했습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.3390/v13030499
To design our assay, all available HMPV full-length genome sequences were downloaded from the National Center for Biotechnology Information (NCBI) GenBank database and used to design four primer sets to amplify long, overlapping amplicons spanning the viral genome and, importantly, specific to all known HMPV subtypes.
우리의 분석을 설계하기 위해 사용 가능한 모든 HMPV 전장 게놈 서열은 NCBI(National Center for Biotechnology Information) GenBank 데이터베이스에서 다운로드되었으며 바이러스 게놈에 걸쳐 있고 중요하게는 특정 유전자에 특이적인 길고 겹치는 앰플리콘을 증폭하기 위해 4개의 프라이머 세트를 설계하는 데 사용되었습니다. 알려진 모든 HMPV 하위 유형.
To design our assay, all available HMPV full-length genome sequences were downloaded from the National Center for Biotechnology Information (NCBI) GenBank database and used to design four primer sets to amplify long, overlapping amplicons spanning the viral genome and, importantly, specific to all known HMPV subtypes.
우리의 분석을 설계하기 위해 사용 가능한 모든 HMPV 전장 게놈 서열은 NCBI(National Center for Biotechnology Information) GenBank 데이터베이스에서 다운로드되었으며 바이러스 게놈에 걸쳐 있고 중요하게는 특정 유전자에 특이적인 길고 겹치는 앰플리콘을 증폭하기 위해 4개의 프라이머 세트를 설계하는 데 사용되었습니다. 알려진 모든 HMPV 하위 유형.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.1101/2021.02.11.430762
Because of their popularity, the National Center for Biotechnology Information (NCBI) receives a disproportionate number of rRNA sequence submissions and BLAST queries.
그들의 인기 때문에 NCBI(National Center for Biotechnology Information)는 불균형적인 수의 rRNA 서열 제출 및 BLAST 쿼리를 받습니다.
Because of their popularity, the National Center for Biotechnology Information (NCBI) receives a disproportionate number of rRNA sequence submissions and BLAST queries.
그들의 인기 때문에 NCBI(National Center for Biotechnology Information)는 불균형적인 수의 rRNA 서열 제출 및 BLAST 쿼리를 받습니다.
Full Text
More Biotechnology Information 생명 공학 정보 sentence examples
10.31083/jomh.2021.051
Materials and methods: We obtained the rat liver tissue gene datasets (GSE63742) collected following partial hepatectomy (PH) from the Gene Expression Omnibus (GEO) of the National Center for Biotechnology Information (NCBI), from which, this study screened the late stage LR samples (7 days post-PH) using the R/Bioconductor packages for the identification of differentially expressed genes (DEGs).
재료 및 방법: 본 연구에서는 NCBI(National Center for Biotechnology Information)의 유전자 발현 옴니버스(GEO)에서 부분 간절제술(PH) 후 수집한 쥐 간 조직 유전자 데이터 세트(GSE63742)를 얻었습니다. 차등적으로 발현된 유전자(DEG)의 식별을 위해 R/Bioconductor 패키지를 사용하는 LR 샘플(PH 후 7일).
Materials and methods: We obtained the rat liver tissue gene datasets (GSE63742) collected following partial hepatectomy (PH) from the Gene Expression Omnibus (GEO) of the National Center for Biotechnology Information (NCBI), from which, this study screened the late stage LR samples (7 days post-PH) using the R/Bioconductor packages for the identification of differentially expressed genes (DEGs).
재료 및 방법: 본 연구에서는 NCBI(National Center for Biotechnology Information)의 유전자 발현 옴니버스(GEO)에서 부분 간절제술(PH) 후 수집한 쥐 간 조직 유전자 데이터 세트(GSE63742)를 얻었습니다. 차등적으로 발현된 유전자(DEG)의 식별을 위해 R/Bioconductor 패키지를 사용하는 LR 샘플(PH 후 7일).
Full Text
Learn more from Biotechnology Information 생명 공학 정보
Keywords related to Biotechnology
Biotechnology Industries
Biotechnology Sector
Biotechnology Firms
Biotechnology Application
Biotechnology Research
Biotechnology Techniques
Biotechnology Companies
Biotechnology Approach
Biotechnology Industry
Biotechnology Innovation
Biotechnology Applications
Biotechnology Products
Biotechnology Regulations
Explore More
Keywords related to Information
Sustainable Information
Cognitive Information
Drought Information
Laboratory Information
Multiscale Information
Domain Specific Information
Real Information
Alteration Information
Sensitive Information
Doppler Information
Credibility Information
Introducing Information
Leaking Information
Radar Information
Life Information
Intellectual Information
Convergence Information
Impact Information
Processing Information
Insurance Information
Multisensor Information
Perceptual Information
Medicines Information
Teratology Information
Modelling Information
Silence Information
Aware Information
Hierarchical Information
Physiological Information
Drug Information
Vaccines Information
Demographic Information
Silent Information
Predictive Information
Orthographic Information
Shape Information
Marker Information
Decision Information
Functional Information
Unified Information
Feeding Information
Responsibility Information
Complete Information
Archives Information
Preview Information
Von Information
Village Information
Kinetic Information
Remote Information
Topographical Information
Explore More
Biotechnology Information 생명 공학 정보
Biotechnology Information 생명 공학 정보
Encyclopedia 백과사전